Journal: American Journal of Cancer Research
Article Title: NADPH oxidase 1 in chronic pancreatitis-activated pancreatic stellate cells facilitates the progression of pancreatic cancer
doi:
Figure Lengend Snippet: A. Nox1 is not expressed in pancreatic cancer cell lines HPAC, MIA Paca-2 and PANC1. We isolated total RNA from pancreatic cancer cell lines using RNeasy® Mini kit, synthesized first-strand complementary DNA with TaqMan RT-PCR kit, used one μg of complementary DNA in each PCR reaction and conducted amplification with Taq DNA polymerase from Expand High Fidelity Enzyme Mix kit using specific primers (human Nox1: Forward: 5’-TCA TCC TCG CAA GTG TGC AGA GTC-3’ and Reverse: 5’-ACT TCC ATG CTG AAG CCA CGC T-3’; human actin: forward: 5’CCCAGCACAATGAAGATCAA3’; reverse: 5’ACATCTGCTGGAAGGTGGAC3’). PCR products yielded bands of the expected size (human Nox1: 248 bp and human actin: 103 bp). We used human DNA mix from GeneCopoeiaTM as positive controls. Results were representative of 3 independent experiments. B. The lack of Nox1 in activated PaSCs with CP reduces the tumor growth in an orthotopic nude mouse model of pancreatic cancer. The pancreas of NSGTM mice was co-injected with MIA PaCa-2 cells (6-6.5 × 104) and activated PaSCs from Nox1-competent mice or Nox1-null mice with CP (40-60 × 104). At week 6, mice were euthanized and pancreas weight/body weight (PW/BW) ratio was determined. Statistical Analysis: One-way ANOVA followed by Student-Newman-Keuls post hoc performed by Instat Graphpad software (La Jolla, CA). ***: P<0.001 versus NSGTM mice without transplantation of MIA PaCa-2 or activated PaSCs with CP. n: 5 independent male mice. C. Changes in gene expression in the whole pancreas from an orthotopic xenograft model of PDAC. Data were expressed as fold change in gene expression relative to male NSG mice (mean ± SEM). 18S rRNA was used as a reference. Statistical Analysis: Two-way ANOVA followed by Student-Newman-Keuls post hoc was performed by Instat Graphpad software (La Jolla, CA). *: P<0.05 and ***: P<0.001 vs NSG mice; ††: P<0.01, and †††: P<0.001 vs NSGTM mice + MIA PaCa-2 cells + activated PaSCs from WT mice with CP. n: 5 independent male mice. D. The lack of Nox1 in activated PaSCs reduces stromal expansion in an orthotopic nude mouse model of pancreatic cancer. We lysed pancreatic tissues using a lysis buffer. We separated the proteins on polyacrylamide gels and transferred them to a nitrocellulose membrane. We visualized immunocomplexes with the Super Signal West Femto substrate kit. Representative immunoblots for mouse fibronectin (300 kDa), collagen IA (220 kDa), collagen IV (200 kDa), LAMC1 (220-250 kDa), αSMA (42 kDa), vimentin (57 kDa), desmin (53 kDa), MMP-9 (92 kDa), keratin 19 (TROMAIII) (44.5 kDa) were shown. n: 3 independent male mice. E. Either keratin 19 or desmin is not present in MIA PaCa-2 cells. Cell lysates of well-differentiated HPAC cells and two undifferentiated cell lines MiaPaca-2 and PANC-1 were prepared, and Western blotting analysis was carried out. Representative immunoblots for human collagen IV (200 kDa), LAMC1 (220-250 kDa), keratin 19 (TROMAIII) (44.5 kDa) and desmin (53 kDa) were shown. Higher levels of LAMC1 and keratin 19 were found in HPAC cells, while keratin 19 and desmin were absent in MIA PaCa-2 cells. A pancreatic tissue lysate from NSGTM mice + MIA PaCa-2 cells was used as a positive control of desmin. α-tubulin (52 kDa) was used as a loading control. n: 4 independent experiments.
Article Snippet: We observed a 3-fold increase in amylase release at 1 × 10 -10 M based on previous results in the lab using cholecystokinin-8 [ 29 ]. . Antibodies Antibodies against the following proteins were used: rabbit polyclonal antibodies to collagen 1A1 (#84336), laminin gamma-1 (LAMC1) (#92921), rabbit monoclonal antibodies to calponin-1 (#17819), vimentin (#5741), α-smooth muscle actin (SMA) (#19245), thioredoxin reductase 1 (TrxR1) (#15140), connective tissue growth factor (CTGF) (#86641), protein disulfide-isomerase (PDI) (#3501), desmin (#5332), human MMP-9 (#13667), human fibronectin (#26836), collagen 1A1 (#84336); mouse monoclonal antibodies to α-tubulin (#3873) were provided by Cell Signaling Technology (Beverly, MA); mouse monoclonal antibody against Twist1 (NBP2-37364) from Novus Biologicals (Centennial, CO); rabbit polyclonal antibody against mouse fibronectin (#AB2033) from EMD Millipore Corp (Temecula, CA), goat polyclonal antibody against mouse MMP-9 (#AF909) from R&D Systems (Minneapolis, MN), rabbit polyclonal antibody against mouse collagen IV (#2150-1470) (only used in immunohistochemistry; it did not work in Western blotting) from Bio-Rad (Hercules, CA), rabbit polyclonal antibody against human collagen IV (SAB4300752) from Sigma-Aldrich (St. Louis, MO), rat monoclonal against cytokeratin 19 (TROMA-III) from Developmental Studies Hybridoma Bank, mouse monoclonal antibody against Prdxs 1,2,4 (#sc-137222), anti-mouse IgG, horseradish peroxidase (HRP)-linked (7076) and anti-rabbit IgG, HRP-linked (7074) from Cell Signaling Technology (Beverly, MA).
Techniques: Isolation, Synthesized, Reverse Transcription Polymerase Chain Reaction, Amplification, Injection, Software, Transplantation Assay, Expressing, Mouse Assay, Lysis, Western Blot, Positive Control
